Table 1: Hybridization probes and their corresponding melting temperature.
| # | Protein seq. ( DNA Source) | Probe Sequence (5’-3’) | Tm°C |
| 1 | DWV(I)YEEE probe (degenerate) | 5’GAYTGGGTN(ATH)TAYGARGARGAR3’ | 54 |
| 2 | DWVYEEE probe (Drosophila AC017322) | 5’GATTGGGTGTACGAGGAAGAG3’ | 62.6 |
| 3 | DDNVHYQ probe (Drosophila AC017322) | 5’GATGATAATGTGCACTACCAGCAG3’ | 62.9 |
| 4 | 3’ AC Probe (extreme 3’ end of AC017322) | 5’CAGCTGCTACTAGAGAAGTGAG3’ | 62.7 |
| 5 | 5’ UTR exon 2 probe (AC017322-5’end of exon 2) | 5’CTGCAAAGTTAAGCGCGGGAA3’ | 62.6 |
| 6 | 5’ UTR exon 1 probe (AC017215-5’end of exon 1) | 5’CGGTTCGGTTTCGGTTACGGT3’ | 64.5 |