 |
Demonstration of the protective effects of fluorescent proteins in baculoviruses exposed to ultraviolet light inactivation
AH McIntosh, JJ Grasela, L Lua1 and SC Braunagel2
ABSTRACT
Introduction
Materials and Methods
Results
Discussion
Acknowledgements
References
Autographa californica multiple nucleopolyhedrovirus (AcMNPV) recombinants, namely AcRFP produced by fusion of the red fluorescent protein (RFP) gene with the polyhedrin gene, and a recombinant (pAcUW21-23GFP) carrying the green fluorescent protein (GFP) in its viral envelope, were evaluated for their resistance to inactivation by ultraviolet light. AcRFP recombinants produced incomplete polyhedra with low infectivity for Trichoplusia ni larvae, whereas AcuW21-23GFP produced normal polyhedra with high infectivity. Electron microscopy of AcRFP CL14 showed the incorporation of very few viral particles into polyhedrin matrix protein material. The LC50 for AcuW21-23GFP was 0.10 occlusion bodies/mm2, whereas the LC50 values for several AcRFP recombinants ranged from 20 to 329 occlusion bodies/mm2. When both the RFP and GFP recombinants were exposed to ultraviolet light (UV-B 280-320 nm), the results support the conclusion that these fluorescent proteins afford some protection against its damaging effects.
INTRODUCTION
Abstract
Materials and Methods
Results
Discussion
Acknowledgements
References
Baculoviruses belong to the family Baculoviridae and are the viral agents of choice for the control of insect pests. Because they have some unique properties such as their virulence, specificity within the phylum Arthropoda, non-infectivity for beneficial insects and higher animals and their biodegradable nature, several of these insect viruses, called nucleopolyhedroviruses and granuloviruses, have been commercialized for insect control (Moscardi 1999). Most of the attention has been concentrated on the nucleopolyhedroviruses that infect Lepidopteran hosts. These baculoviruses have a biphasic replicative cycle in which two forms of the virus are produced in the infected cell, one that buds from the cytoplasmic membrane and is commonly referred to as budded virus or extracellular virus, and the other in which the viral particles are occluded into a protein matrix called an occlusion body (OB). The particles in occlusion bodies are called occlusion derived virus (ODV) and initiate infection in the host following consumption of contaminated parts of the plant and their release in the alkaline midgut. The infection results in the production of budded virus that then disseminates to various target sites in the host. Thus, budded virus is responsible for spreading the infection within the host, whereas occlusion bodies, which are released from infected larvae through lysis, spread the virus in the environment between hosts.
One of the limitations of the use of baculoviruses as biological control agents is their loss of activity under field conditions due to inactivation by ultraviolet light (UV), with most of the activity being lost within 24 h. Most of the studies to address this deficiency have centered on the use of microencapsulation and additives such as UV protectants (Ignoffo and Batzer 1971) and fluorescent brighteners (Shapiro and Vaughn 1995) to reduce or prevent inactivation by UV light. In vitro studies (Grasela et al. 2002) have demonstrated that cells in culture can serve as a protective device against inactivation by UV light, by either serving as a physical barrier or by some mechanism in which cells repair damaged DNA. In the present study, we employ a genetic approach by expressing fluorescent proteins in occlusion bodies and in the envelopes of ODV in order to determine if these compounds afford protection against the damaging effects of UV light (UV-B 280–320 nm).
MATERIALS AND METHODS
Abstract
Introduction
Results
Discussion
Acknowledgements
References
Baculoviruses and cell culture
AcMNPV-HPP (McIntosh et al. 1992), a clone of the wild-type AcMNPV, a red fluorescent protein (RFP) AcMNPV recombinant, a green fluorescent protein (GFP) AcMNPV recombinant, and pAcUW21-23GFP (Hong et al. 1997) were produced in the TN-CL1 cell line (McIntosh and Ignoffo 1989). The occlusion bodies were harvested and enumerated as previously described (Grasela and McIntosh 1998). AcMNPV- RFP recombinants (AcRFPCL1, AcRFPCL2 and AcRFPCL14) were randomly selected and purified several times by standard plaque purification and end point dilution methods (McIntosh et al. 1997: Lynn 2003). TN-CL1 cells were inoculated with purified recombinants at a multiplicity of infection of 5 and incubated at 28° C for 5 days at which time OB were recovered and enumerated.
Construction of the red fluorescent protein (RFP) recombinant
The generation of the AcMNPV-RFP in which the RFP gene was fused to the polyhedrin gene was accomplished in two stages. In the first step a cloning technique based essentially on the report by Gritsun et al. (1997) with some minor modifications was employed. Oligonucleotide primers(1)5'-AAGTAAAGG AGTTTGCACCAGACGCACCTCTGTTCACTGG TCCGGCGTATAGGTCTTC CAAGAATGTTATC and (2) 5'-CGCACAGAATCT AGCGCTT AATAAATGTACTAATAACAA TGTATCGTGTTCTAAAGGA ACAGATGGTGGCG, designed to amplify the coding sequence of the RFP gene of the prokaryotic expression vector pDsRed (Clontech, BD Biosciences, www.clontech.com), were synthesized by the University of Missouri–Columbia DNA Core facility. The primers were designed such that during the PCR amplification process an amplicon would be generated with 55 bases (flanking region) at the 3'-end of the polyhedrin gene plus the first15 bases at the 5'-end of the RFP gene. The other flanking region consisted of 55 bases immediately downstream of the polyhedrin gene plus the last 15 bases of the 3' end of the RFP gene. The primers were also designed such that the termination codon of the polyhedrin gene and the initiation transcription site of the RFP gene were absent in the amplicon (Fig. 1). Ready-to-go PCR beads (Amersham Pharmacia Biotech, www.amershambiosciences.com) were used essentially as recommended by the manufacturer to amplify the RFP amplicon. Each PCR sample contained 10 pmol/µl of each primer, 1 µg/µl of pDsRed expression vector, 17 µl sterile MilliQ water, and 2 µl 10mM MgCl2 in 25 µl total volume. Running conditions using an Omni Gene Hybaid thermal cycler were as follows: 95EC for 2 min, (1X); 95EC for 5 sec, 40° C for 1 sec, 72° C for 30 sec (40X); 72° C for 5 min (1X); held at 15° C. To verify if the amplification was successful 10 µl of the sample was run on a 1.5% Metaphor gel (BioWhittaker Molecular Applications, www.bioresearchonline.com/storefronts/biowhittaker.html) at 120 constant voltage for 1 h and stained with 1.0 µg of ethidium bromide in 250 ml TBE buffer. DNA bands containing the expected RFP gene with flanking regions were excised from the gel and extracted using GFX™ PCR DNA and Gel Band Purification kit (Amersham). This amplicon was then used in co-transfection experiments with wt AcMNPV DNA to generate AcMNPV-RFP recombinants. DNA was then extracted from semi-purified (containing wt AcMNPV) RFP recombinants and the complete fusion gene (polyhedrin + RFP) was then amplified from this mixture by long DNA template PCR under the following conditions: 95° C, 10 sec; 58° C, 30 sec; 72° C, 3 min 10X; then 95° C, 10 sec; 58° C, 30 sec; 72° C, 3 min, plus a 30 sec increment 20X; 15° C, hold. The upstream and downstream primers, designed to amplify a 1465-bp polyhedrin -RFP gene fusion amplicon were: 5'-TAACCATCTCGCAA ATAAATAAGTA TTTTACTG TTTTCG and 5'-AATTGT CTGTAAATCAACAACGC ACAGAATCTAG CGCT, respectively. These two primer sequences were designed such that during co-transfection of the PCR-amplified RFP amplicon and wild type AcMNPV DNA, the termination codon of the polyhedrin gene from the wild type viral DNA and initiation codon of the RFP gene would be deleted while the initiation site from the polyhedrin gene and the termination signal from the RFP coding sequence would be retained during allelic recombination. This would generate a continuous coding sequence containing both the polyhedrin and RFP genes for incorporation into the viral genome by allelic recombination that would express a complete, functional polyhedrin-RFP fusion protein. These molecular modifications permit a continuous read-through transcription of the fused polyhedrin and RFP gene sequences. Ready-to-go PCR beads were used as previously described.
Isolation of DNA from OB
The Puregene DNA extraction kit (Gentra, Systems Inc., http://mbbnet.umn.edu/company_folder/gsi.html) and isolation methodology with modifications (McIntosh et al. unpublished) were used to isolate DNA from OB as follows. Occlusion derived virus was recovered from approximately 107 OB by alkali treatment as previously described (McIntosh and Ignoffo 1988). The sample was then incubated in a water bath at 60° C for 15 min and cooled to room temperature. Next, proteinase K was added to give a final concentration of 200 µg/ml and incubated for 2 h in a 37° C water bath followed by cooling at room temperature. Protein precipitation solution (1.7 ml) was added and vortexed at high speed for 20 sec, and spun at 10,000 × g for 3 min in a BHG Hermle Z230M table-top centrifuge. The supernatant was poured into a clean 15 ml glass tube containing 2 ml isopropanol and inverted 50X and centrifugated at 10,000 × g for 1 min. The supernatant was then poured off and 2 ml of 70% ethanol was added to wash the DNA pellet. The ethanol was poured off after centrifugation at 10,000 × g for 3 min and allowed to air dry for 15 min. About 175 µl of DNA hydration solution was added to the sample and allowed to stand overnight at room temperature. DNA was quantified using a Gene Quant II (Amersham Pharmacia Biotech, Piscataway, NJ).
Verification of the recombinant RFP by determination of the polyhedrin-RFP fusion gene junctions
It was necessary after the cloning and isolation of the recombinant baculovirus (AcRFPCL14) to verify its identity by actual DNA sequence, as was expected to be generated by the above designed oligonucleotide primers, at the upstream-junction between the 3'-end of the polyhedrin gene and 5'-end of the RFP gene as well as the downstream-junction between the 3'-end of the RFP gene and the immediate down-stream flanking region of the polyhedrin gene.
To sequence these two junctions, DNA from ca. 107 OB/ml of recombinant virus was extracted employing the above procedure. The following primers were designed to amplify the two junctions: (1) 5'- ATTCTCCTTGA AGTTT CCCTG and 5'- CTCGTGCCCATTGACCGTTCC for the up-stream junction, and (2) 5'-TAACAAGC CACAACGAAGACT and 5'- ACGCACAGAATCTAGCGCTTA for the down-stream junction. Both primer synthesis and DNA sequencing was conducted by the University of Missouri-Columbia DNA Core facility. The fidelity of the predicted DNA sequences of the two above described junctions were confirmed by performing DNA sequencing twice, thus verifying the successful generation of the recombinant. Based on the size of the polyhedrin-RFP fusion gene plus genomic DNA generated by Bam HI digestion of AcRFP CL14 DNA, a predicted fragment of approximately 2611 bp was observed in the gel profile of the recombinant DNA but was absent in the wt AcMNPV DNA profile. Bam HI would typically cut the wild type AcMNPV DNA at a site 200 bp into the polyhedrin gene and at another site further downstream resulting in a 1932 bp restriction fragment, as well as at other sites. With the insertion of the RFP gene at the 3'-end of the polyhedrin gene and subsequent Bam HI digestion of the recombinant DNA, this same fragment was extended to 2611 bp by the addition of the 677 bp RFP gene.
Co-transfection of insect cells
TN-CL1 cells grown in ExCell 401 (JRH Biosciences, www.jrhbio.com) plus 10% heat inactivated (56° C/30 min) fetal bovine serum (Summit Biotechnology, www.biobank.co.kr/maker/sss/summit.shtml) were seeded into 24 well plates at 1 × 105 cells/ml/well and incubated for several hours, or overnight at 28° C. DNA derived from the occlusion virus of AcMNPV-HPP was used at a concentration ranging from 125 ng/5 ml to 500 ng/5ml, whereas the RFP amplicon or the polyhedrin-RFP amplicon was used at 3x the concentration of Ac-HPP DNA. Prior to co-transfection, the medium was removed and the cells gently washed with fresh 0.5 ml of ExCell 401 without fetal bovine serum and the medium removed and fresh 0.5 ml serum free medium added. To each sample tube containing Ac-HPP- DNA and amplicon DNA, 3 µl of transfection reagent (Mirus TransIT®-LT-2, PanVera, Corp., www.invitrogen.com) was added and brought up to 50 µl total volume with sterile water and the samples were incubated at 28° C for 15 min. The contents of each tube were then added in a drop-wise manner to each well containing cells, mixed gently by rocking and incubated at 28° C for 5 hr. At the end of this period, 1 ml of serum-free medium containing 50 units/ml penicillin, 50 µg/ml streptomycin, and 60 µg/ml gentamycin (stock10 µg/ml) were added to each well and cells incubated for 5–7 days or until a cytopathogenic effect (CPE) was observed. Cells that were successfully co-transfected were readily identifiable under UV light by their red fluorescence employing an Olympus CK2 microscope with a BH2-RFC attachment.
In vivo and in vitro bioassays
All bioassays were conducted by topical application of virus preparation (based on OB counts or dilutions of the original OB suspension) to individual wells containing a semi-synthetic diet (Ignoffo 1965). Twenty-five one day old T. ni larvae/dose were exposed in triplicate and the percent mortality was recorded at 7 days following incubation at 30° C. LC50 values were calculated by probit analysis as previously described (Kariuki and McIntosh 1999). TN-CL1 was used as the indicator cell line for the quantification of viral titers (TCID50/ml) of extracellular virus or budded virus by a previously described method (Grasela and McIntosh 1998).
For mortality studies, each AcRFP recombinant as well as Ac-HPP was produced in a T-75 cm2 flask of TN-CL1 cells at an multiplicity of infection of 5 and cell pellets were recovered at the end of the incubation period by centrifugation at 3,000 × g for 30 min in a Beckman Model TJ-6 table top centrifuge (Beckman Coulter, Inc. www.beckman.com). Each cell pellet was standardized by re-suspension in 10 ml of ultra-pure water and sonicated through several cycles at 50 watts in a Sonifier Cell Disruptor, Model W185 (Heat Systems-Ultrasonics Inc. Plainview, N.Y.). This 10 ml volume represented the original suspension from which serial dilutions were made to perform mortality studies.
Exposure to Ultraviolet Light (UV-B)
Samples were exposed by placing 2 ml of the OB suspensions in wells of a 12 well plate (Corning, Costar, www.corning.com). Half of the wells were covered with aluminum foil (shielded) and the other half were not shielded. Samples were exposed for various periods of time to ultraviolet light, UV-B (280–320 nm), in the chamber of a Suntest CPS system (Atlas Electric Devices Co., Chicago, IL). The dose rate was 3600 KJ/m2×2h. Following exposure, samples were bioassayed against T. ni larvae and mortalities and LC50 values calculated. Based on half-life values of baculoviruses, 1 min in the Suntest CPS chamber is equivalent to 20 min of exposure to outdoor sunlight. The half-life of baculoviruses tested was found to be 4.8 min in the Suntest CPS chamber (C. Ignoffo, personal communications).
Electron Microscopy
Samples were prepared for transmission electron microscopy as previously described (Kariuki and McIntosh 1999) and were processed by the Electron Microscopy Core Facility at the University of Missouri, Columbia.
RESULTS
Abstract
Introduction
Materials and Methods
Discussion
Acknowledgements
References
The results of infectivity studies of the AcMNPV recombinants, AcRFPCL1, AcRFPCL2, AcRFPCL14 and pAcUW21-23GFP, as well as a clone (Ac-HPP) of the wild-type (wt) AcMNPV, are presented in Table 1. The highest TCID50 titers were recorded for AcRFPCL2 (1.15 × 108), AcRFPCL14 (9.49 × 107) and Ac-HPP (1.15 × 108). AcRFPCL1 and pAcUW21-23GFP gave lower TCID50 titers of 3.30 × 106 and 1.15 × 106 respectively.
When examined under UV light, AcRFPCL14 infected TN-CL1 cells gave bright red fluorescence that was distinct in nature compared with a more diffused fluorescence for pAcUW21-23GFP (Fig. 2). The other AcRFP recombinants displayed a fluorescence similar to that of AcRFPCL14.
All of the AcRFP recombinants gave significantly higher LC50 values (low infectivity) than pAcUW21-23GFP (LC50 = 0.1 OB/mm2) (Table 1). T. ni larvae that were infected with AcRFP recombinants typically showed a pink to red color under ordinary light as depicted in Figure 3. It was considered that low infectivity of AcRFP recombinants might be due to an error in the enumeration of OB counts since counts were based on fluorescent particles which might not be OB, or incompletely formed OB. Consequently, mortality studies based on serial dilutions of standardized sonicated cell pellet suspensions and not on OB counts were performed. Results of such studies are presented in Table 2 and confirm the low infectivity of the recombinants. At the 10-2 dilution, AcRFPCL1, AcRFPCL2 and AcRFPCL14 gave mortalities of 4%, 16% and 46.6% respectively, whereas at a dilution of 10-4 Ac-HPP gave a mortality of 92%.
AcRFPCL14 was selected for further electron microscopy studies and exposure to UV light inactivation. To determine whether or not OB were incompletely formed and thus occluded fewer viral particles, transmission electron microscopy studies were conducted on AcRFPCL14. Figure 4 illustrates the incomplete assembly of the polyhedrin protein matrix that appears as grayish material with few viral particles occluded (arrow). Many viral particles can be seen outside these irregular shaped bodies as well as illustrated in Figure 5. Figure 6 is a higher magnification of Figure 4 showing virions at the edge of the polyhedrin matrix.
The results of UV-B studies are presented in Table 3 and show that both AcRFPCL14 and AcGFP recombinants afforded protection to the ODV when exposed to the detrimental effects of UV light. Although the infectivity of the AcRFPCL14 recombinant is much lower than the Ac-HPP, nevertheless the former afforded better protection against UV-B (33.7 fold = 78.6/2.33) as compared with Ac-HPP. The pAcUW21-23GFP recombinant gave the best protection against UV-B compared with the AcRFPCL14 (3-fold) recombinant and Ac-HPP (102-fold). Even prolonged exposure of pAcUW21-23GFP OB for 4 h to UV-B did not result in extensive inactivation of the virus giving a non-shielded to shielded ratio of 6.5. A non-shielded to shielded ratio of <= 1 would indicate no inactivation by UV-B.
DISCUSSION
Abstract
Introduction
Materials and Methods
Results
Acknowledgements
References
The recombinants AcRFPCL1, AcRFPCL2 and AcRFPCL14 represent different clonal isolates selected randomly following co-transfection. The differences in infectivity results between these recombinants as represented in Table 1 may be a reflection of inaccurate fluorescent OB counts, since the particles were irregular in shape and size, and attempts were made to count only those particles that approximated the size of normal occlusion bodies. Alternatively the low number of viral particles incorporated into the OB-like protein matrix material may account for differences in observed infectivity and is supported by the observed mortality studies (Table 2) which were not based on OB counts. It was not possible to determine from these studies whether or not ODV particles in OB from the AcRFP recombinants were less infectious than those occurring in AcMNPV-HPP occlusion bodies but the budded virus particles from recombinants appear to be normal since the purified clones gave relatively high infectious titers as observed in Table 1.
The irregular shaped greyish material in the electron microphotographs (Figs. 4, 5, 6), showing virus assembly in the nucleus, is incompletely formed polyhedrin protein matrix and supports the fluorescent light microscopy observation of irregularly shaped fluorescent bodies. Many viral particles do not have a membrane or envelope and this may be the reason why more viral particles are not occluded. In a normal assembly process, once polyhedrin matrix is detected in the nucleus, most of the nucleocapsids would have their envelopes through the intranuclear nucleocapsid envelopment process to become ODV. The membrane on ODV is a requirement for virion occlusion and thus the observations in this electron microscopy study suggest that there is an impairment in the intranuclear nucleocapsid envelopment process. The absence of nucleocapsids in the virogenic stroma (Fig. 4) may be a reflection of a late stage in the infection cycle.
One of the major disadvantages in the use of microbial biological control agents is their inactivation following exposure to UV light in the environment (Jacques 1968, Bullock et al. 1970, Jones and McKinley 1986). UV-B (280–320 nm) is believed to be the major cause of inactivation of microbials (Jacques 1977, Jones and McKinley 1986) with pathogens losing 50% of their activity within several days (Ignoffo et al. 1977) and in some cases within 24 hours (Broome et al. 1974). One of the approaches that has been employed with the expectation of decreasing inactivation by UV-B has been the addition of UV protectants such as dyes and optical brighteners to formulations (Shapiro and Robertson 1990, Shapiro and Vaughn 1995). Also, Grasela et al. (2002) demonstrated that insect cells can protect virus from inactivation by UV-B. In that study, it was not known whether such protection was due to some DNA repair mechanism or to physical protection by the cells. It is unlikely such an approach would find applicability of baculoviruses in the environment since the presence of insect cells would be required. A more recent report (Petrik et al. 2003) employed a DNA repair enzyme whose gene was engineered into AcMNPV for repairing any damage that might have occurred to DNA following exposure to UV light. This approach, however, involves repair after damage has occurred and would require the presence of insect cells for the replication and repair of the damaged viral DNA. Furthermore if ultraviolet inactivation of the repair enzyme gene had occurred the potential restorative effect would be negated. In the present investigation, we considered a genetic approach in which we genetically engineered fluorescent protein genes into AcMNPV with the expectation that the expressed protein would absorb some of the damaging ultraviolet radiation. Although the fusion of a red fluorescent protein (RFP) gene to the polyhedrin gene resulted in a decrease in infectivity, nevertheless it did afford some protection to the occluded derived virus. Other fusion attempts of another fluorescent gene (GFP) to the polyhedrin gene did not result in formation of OB but when native polyhedrin was introduced with the fusion gene complex normal infectious occludion bodies were formed (Je et al. 2003). In those studies the recombinant was not tested for resistance to UV-B.
To more accurately assess which of the two, GFP or RFP, gives better protection against UV light, they should be both compared on the same basis (i.e., both recombinants as fusion products of the polyhedrin gene or incorporation of GFP and RFP in the envelopes of budded virus). The excitation maxima of GFP, RFP and an enhanced blue fluorescent protein (EBFP) are 395 nm, 558 nm and 380 nm respectively. Although the mechanism of the protective effect of RFP and GFP in the present study is unknown, and even though these maxima are greater than the wavelength of UV-B (280–320 nm), nevertheless they may have an overlapping protective effect. Also, with regards to sunlight-UV, it has been reported that UV-A (320–400 nm) may also contribute to inactivation of baculoviruses (Morris 1971, Shapiro and Domek 2002) and UV-C (250–280 nm) is even more damaging to DNA.
ACKNOWLEDGEMENTS
Abstract
Introduction
Materials and Methods
Results
Discussion
References
We thank Dr. Carlo Ignoffo for providing information on the Atlas Suntest CPS UV chamber and UV-B inactivation of baculoviruses.
Disclaimer: Mention of trade names or commercial products in the publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the US Department of Agriculture.
REFERENCES
Abstract
Introduction
Materials and Methods
Results
Discussion
Acknowledgements
Broome, JR, PP Sikorowski, and WW Neel. 1974. Effect of sunlight on the activity of nuclear polyhedrosis virus from Malacosoma disstria. Journal of Economic Entomology 67:135–136.
Bullock, HR, JP Hollingsworth, and AW Hartstack Jr. 1970. Virulence of Heliothis nuclear polyhedrosis virus exposed to monochromatic ultraviolet irradiation. Journal of Invertebrate Pathology 16: 419–422.
Grasela, JJ and AH McIntosh. 1998. In vitro and in vivo host range of Anticarsia gemmatalis multiple nuclear polyhedrosis virus. In Vitro Cellular & Developmental Biology 34: 79–83.
Grasela, JJ, AH McIntosh, CM Ignoffo, and CL Goodman. 2002. Insect cells and their potential as stabilization barriers for DNA of multiple and single nucleopolyhedroviruses against ultraviolet-B-simulated sunlight inactivation. In Vitro Cellular & Developmental Biology 38: 173–177.
Gritsun, TS, MV Mikhailov, P Roy, and EA Gould. 1997. A new, rapid and simple procedure for direct cloning of PCR products into baculoviruses. Nucleic Acids Research 25(9): 1864–1865.
Hong, T, MD Summers, and SC Braunagel. 1997. N-terminal sequences from Autographa californica nuclear polyhedrosis virus envelope proteins ODV-E66 and ODV-E25 are sufficient to direct reporter proteins to the nuclear envelope, intranuclear microvesicles and the envelope of occlusion derived virus. Proceedings of the National Academy of Science USA 94: 4050–4055.
Ignoffo, CM. 1965. The nuclear-polyhedrosis virus of Heliothis zea (Boddie) and Heliothis virescens (Fabricus). IV. Bioassay of virus activity. Journal of Invertebrate Pathology 7: 315–319.
Ignoffo, CM and OF Batzer. 1971. Microencapsulation and ultraviolet protectants to increase sunlight stability of an insect virus. Journal of Economic Entomology 64: 850–853.
Ignoffo, CM, DL Hostetter, PP Sikorowski, G Sutter, and WM Brooks. 1977. Inactivation of entomopathogenic viruses, a bacterium, fungus, and protozoan by an ultraviolet light source. Environmental Entomology. 6: 411–415.
Jacques, RP. 1968. The inactivation of the nuclear polyhedrosis virus of Trichoplusia ni by gamma and ultraviolet radiation. Canadian Journal of Microbiology 14: 1161–1163.
Jacques, RP. 1977. Stability of entomopathogenic viruses, pp. 99–116. In CM Ignoffo and DL Hostetter (eds.), Environmental stability of microbial insecticides. Miscellaneous Publications of the Entomological Society 10 (3), College Park, MD.
Je, HE, BR Jin, HW Park, JY Roh, JH Chang, SJ Seo, JA Olszewski, DR O'Reilly, and SK Kang. 2003. Baculovirus expression vectors that incorporate the foreign protein into viral occlusion bodies. BioTechniques 34(1): 81–87.
Jones, KA and DJ McKinley. 1986. UV inactivation of Spodoptera littoralis nuclear polyhedrosis virus in Egypt: assessment and protection, p. 155. In RA Sampson, JM Vlak, and D Peters, (eds.), Fundamental and applied aspects of invertebrate pathology, Proceedings IV International Colloquium of Invertebrate Pathology, Wageningen, The Netherlands.
Kariuki, CW and AH McIntosh. 1999. Infectivity studies of a new baculovirus isolate for the control of the diamondback moth (Plutellidae: Lepidoptera). Journal of Economic Entomology 92(5): 1093–1098.
Lynn, D. 2003. Comparative susceptibilities of insect cell lines to infection by the occlusion body derived phenotype of baculoviruses. Journal of Invertebrate Pathology. 83: 215–222.
McIntosh, AH, Goodman, CL, and Grasela, JJ. 1997. Virus production and plaque-forming ability of Helicoverpa zea (Lepidoptera: Noctuidae) clonal cell lines. Applied Entomology and Zoology. 32(4): 657–658.
McIntosh, AH and CM Ignoffo. 1988. Effect of larval extract and proteinase K on the in vitro infectivity of Heliothis zea nonoccluded and alkali-liberated virions. Applied Entomology & Zoology 23(2): 175–180.
McIntosh, AH and CM Ignoffo. 1989. Replication of Autographa californica nuclear polyhedrosis virus in five lepidopteran cell lines. Journal of Invertebrate Pathology 54: 97–102.
McIntosh, AH, N Barcenas, and JR Cate. 1992. Replication of Autographa californica baculovirus (AcMNPV) in a Coleopteran cell line. In Vitro Cellular & Developmental Biology 28A: 557–559.
Morris, ON. 1971. The effect of sunlight, ultraviolet and gamma radiation and temperature on the infectivity of a nuclear polyhedrosis virus. Journal of Invertebrate Pathology 18: 292–294.
Moscardi, F. 1999. Assessment of the application of baculoviruses for control of lepidoptera. Annual Review of Entomology. 14: 257–289.
Petrik, DT, I Iseli, BA Montelone, JL Van Etten, and RJ Clem. 2003. Improving baculovirus resistance to UV inactivation: increased virulence resulting from expression of a DNA repair enzyme. Journal of Invertebrate Pathology 82: 50–56.
Shapiro, M and JL Robertson. 1990. Laboratory evaluation of dyes as ultraviolet screens for the gypsy moth (Lepidoptera: Lymantriidae) nuclear polyhedrosis virus. Journal of Economic Entomology 83: 168–172.
Shapiro, M and J Vaughn. 1995. Enhancement in activity of homologous and heterologous baculoviruses infectious to cotton bollworm (Lepidoptera: Noctuidae) by an optical brightener. Journal of Economic Entomology 88 (2): 265–269.
Shapiro, M and J Domek. 2002. Relative effects of ultraviolet and visible light on the activities of corn earworm and beet armyworm (Lepidoptera: Noctuidae) nucleopolyhedroviruses. Journal of Economic Entomology 95: 261–268.
|
 |